معلومة

تنزيل جينات خميرة معينة بطريقة آلية؟

تنزيل جينات خميرة معينة بطريقة آلية؟



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لدي 6 جينات من المبيضات البيض الخميرة وهيorf19.723,أورف 19.5908,orf19.610,orf19.2119,أورف 19.4998وأورف 19.4056. وقد وجدت جينات تقويم العظام المقابلة من موقع معهد برود لـ16 نوعًا آخر من الخميرة. لذلك لدي كل أسماء الجينات. الآن كيف يمكنني على وجه التحديد تنزيل هذه الجينات و من اين هل يمكنني القيام بذلك ، ويفضل أن يكون بطريقة آلية؟

أيضا هل هناك أي اصطلاح تسمية قياسي؟ لأن أسماء ORF المعطاة لها أسماء أخرى مثل BCR1 و EFG1 و NDT80.

قائمة أسماء الجينات التي لدي:

أخصائيو تقويم C. Albicans مع S. cerevisiae orf19.2119 YHR124W orf19.4998 YBR033W YKL034W orf19.5908 YBR083W orf19.610 YMR016C YKL043W orf19.723 NONE orf19.4056 YMR136W. -g1.1 orf19.4998 spar197-g23.1 spar324-g3.1 orf19.5908 spar200-g4.1 orf19.610 spar184-g1.1 spar324-g10.1 orf19.723 none orf19.4056 spar165-g2.1 أخصائيو تقويم C. Albicans مع S. mikatae orf19.2119 NONE orf19.4998 smik146-g12.1 smik109-g17.1 orf19.5908 smik83-g2.1 orf19.610 smik571-g2.1 smik109-g10.1 orf19. 723 NONE orf19.4056 smik1535-g1.1 تقويم العظام من C. Albicans مع S. bayanus orf19.2119 sbayc514-g9.1 orf19.4998 sbayc611-g22.1 sbayc652-g20.1 orf19.5908 sbayc678-g131.1 orf19 .610 sbayc638-g23.1 sbayc652-g27.1 orf19.723 NONE orf19.4056 sbayc657-g41.1 أخصائيو تقويم C. Albicans مع S. castellii orf19.2119 Scas697.24 orf19.4998 Scas625.4 orf19.5908 Scas718 .27 Scas635.12 orf19.610 Scas106.1 Scas709.52 Scas625.8 orf19.723 بدون أو 19.4056 Scas680.22 d تقويمات C. Albicans مع C. glabrata orf19.2119 CAGL0L13090g orf19.4998 CAGL0L01947g orf19.5908 CAGL0M01716g CAGL0F04081g أو 2119 SAKL0E11330g orf19.4998 SAKL0A09812g orf19.5908 SAKL0B06578g orf19.610 SAKL0D13442g orf19.723 SAKL0A03476g orf19.4056 SAKL0E04862g وorthologs من C. المبيضة البيضاء مع K. اللبنية orf19.2119 KLLA0F24420g orf19.4998 KLLA0F25674g orf19.5908 KLLA0E12507g orf19.610 KLLA0F04840g orf19. 723 NONE orf19.4056 KLLA0F17116g مقومو C. Albicans مع A. orf19.2119 Kwal33.14699 orf19.4998 Kwal26.8099 orf19.5908 Kwal27.12423 orf19.610 Kwal26.8176 orf19.723 NONE orf19.4056 Kwal47.17849 مقوامو C. Albicans مع C. Tropicalis orf19.2119 CTRG01097.3 أورف 19.4998 CTRG03636.3 orf19.5908 CTRG02294.3 orf19.610 لا شيء أو 19.723 CTRG00608.3 أو 19.4056 CTRG04523.3 أخصائيو تقويم C. LELG05390 orf19.723 LELG03123 orf19.4056 LELG01761 مقومو C. Albicans مع C. parapsilosis orf19.2119 CPAG04608 orf19.4998 NONE orf19.5908 CPAG01691 orf19.610 CPAG00178 orf19.723 CPAG056 D. hansenii orf19.2119 DEHA2A07282g orf19.4998 NONE orf19.5908 DEHA2G13794g orf19.610 DEHA2E10978g orf19.723 DEHA2E05984g orf19.4056 DEHA2E07172g DEHA2F25916 أو C. 5908 PGUG04378.1 orf19.610 PGUG03651.1 orf19.723 PGUG05571.1 orf19.4056 PGUG05533.1 أخصائيو تقويم C. Albicans مع C. 723 CLUG00627 orf19.4056 CLUG05535

لا تحتوي هذه التسلسلات على أي معرف قياسي. المعلومات الموجودة في قاعدة بيانات جينوم السكارومايس قديمة أيضًا (2005) ولا تحتوي على هذه المعرفات.

يمكن العثور على هذه التسلسلات هنا (في نفس الموقع).

كل نوع له اسم قصير:

ORGANISM الاسم المختصر S.cerevesiae Scer S. bayanus Sbay S. paradoxus Spar A. gossypii Agos… وهلم جرا.

الحرف الأول من اسم الجنس بأحرف كبيرة + أول 3 أحرف من اسم النوع بحروف صغيرة.

ملف فاستا (لجميع ORFs) هو:
www.broadinstitute.org/regev/orthogroups/nt/.fasta

من هناك يمكنك استخدام grep لاسترداد التسلسل.

لذلك ، إذا قمت بحفظ أسماء مختصرة وأسماء جينية ملفين منفصلين ، يمكنك القيام بشيء مثل هذا:

للاسم المختصر في "cat shortname.txt" ؛ قم بإجراء wget -O tmp.fa "http://www.broadinstitute.org/regev/orthogroups/nt/"$shortname.fasta ؛ grep -A 1 -f ids.txt tmp.fa >> اسم قصير $ "_Select.fa"؛ انتهى

حسنًا ، يجب أن تكون الخطوة الأولى هي تعيين كل هذه المعرفات إلى نفس قاعدة البيانات. جرب استخدام http://uniprot.org إذا كنت تريد تسلسلات بروتين أخرى ، فابحث عن كل منها وابحث عن معرف Refseq المقابل. نظرًا لأن لديك معرفات من قواعد بيانات متعددة ، فقد تحتاج إلى google كل على حدة. إذا كنت تعرف نوع المعرف لكل معرف لديك ، فيمكنك استخدام أداة مثل محول الاسم الجيني الخاص بـ DAVID لأتمتة ذلك.

بمجرد الحصول على قائمة بالمعرفات من نفس قاعدة البيانات ، احفظها في ملف (معرف واحد لكل سطر). بعد ذلك ، بالنسبة لمدخلات UniProt ، يمكنك الحصول على تسلسل بروتين FASTA عن طريق تشغيل:

أثناء قراءة الاسم ؛ قم بعمل wget -O - http://uniprot.org/$name.fasta ؛ تم 

بالنسبة لمعرفات RefSeq ، يمكنك استخدام أداة استرداد الدُفعات الخاصة بـ Entrez.


ضغط ذراع كروموسوم الخميرة الاصطناعية

التكرار هو سمة مشتركة في الجينوم ، من المفترض أنه يضمن نموًا قويًا في ظل ظروف مختلفة ومتغيرة. يوفر ضغط الجينوم ، وإزالة التسلسلات غير الضرورية لظروف معينة ، طريقة جديدة لفهم المبادئ الأساسية للحياة. تعد إعادة ترتيب الكروموسوم الاصطناعي وتعديله بواسطة نظام التطور بوساطة loxP (SCRaMbLE) ميزة فريدة مزروعة في جينوم الخميرة الاصطناعية (Sc2.0) ، والتي تم اقتراحها كأداة فعالة لتقليل الجينوم. مع اقتراب مشروع Sc2.0 من الاكتمال ، بدأنا في استكشاف تطبيق نظام SCRaMbLE في ضغط الجينوم.

نتائج

قمنا بتطوير طريقة تسمى ضغط الجينوم المستند إلى SCRaMbLE (SGC) ونوضح أنه يمكن تقليل ذراع الكروموسوم الاصطناعي (synXIIL) بكفاءة. تعمل مجموعة الجينات الأساسية episomal التي تم إدخالها مسبقًا على تعزيز قدرة الضغط لـ SGC بشكل كبير ، ليس فقط من خلال تمكين حذف الجينات غير الأساسية الموجودة في الجين الأساسي الذي يحتوي على وحدات loxPsym ولكن أيضًا عن طريق السماح بإزالة المزيد من متواليات الكروموسومات في عملية SGC واحدة. يتم تحقيق المزيد من الضغط من خلال SGC التكراري ، مما يكشف عن أنه يمكن إزالة ما لا يقل عن 39 من أصل 65 جينًا غير أساسي في synXIIL بشكل جماعي دون التأثير على قابلية الخلية للحياة عند 30 درجة مئوية في وسط غني. تم العثور على ما يقرب من 40 ٪ من التسلسل التركيبي ، الذي يشفر 28 جينًا ، يمكن الاستغناء عنه لنمو الخلايا عند 30 درجة مئوية في وسط غني ، وتم تحديد العديد من الجينات التي تحتاج إلى وظائفها في ظل ظروف محددة.

الاستنتاجات

نقوم بتطوير SGC التكراري بمساعدة eArray كأداة عامة وفعالة لضغط جينوم الخميرة الاصطناعية.


الملخص

نصف التصميم الكامل لجينوم حقيقيات النوى الاصطناعي ، Sc2.0 ، معدل للغاية خميرة الخميرة انخفض حجم الجينوم بنسبة 8 ٪ تقريبًا ، مع حذف 1.1 ميغا قاعدة من الجينوم الاصطناعي أو إدخاله أو تغييره. تم تنفيذ تصميم كروموسوم Sc2.0 باستخدام BioStudio ، وهو إطار مفتوح المصدر تم تطويره لتصميم الجينوم حقيقي النواة ، والذي ينسق تعديلات التصميم من النيوكليوتيدات إلى مقاييس الجينوم ويفرض التحكم في الإصدار لتتبع التعديلات بشكل منهجي. لتحقيق تخليق جينوم كامل لـ Sc2.0 ، سيتم دمج الكروموسومات الاصطناعية الفردية التي تم إنشاؤها بواسطة فرق Sc2.0 Consortium حول العالم في سلالة واحدة عن طريق "التكرار الداخلي المتداخل". الجينومات المركبة كيميائيًا مثل Sc2.0 قابلة للتخصيص تمامًا وتسمح للتجربة بطرح أسئلة مستعصية على خلاف ذلك حول بنية الكروموسوم ووظيفته وتطوره باستخدام استراتيجية تصميم من أسفل إلى أعلى.

الهدف من مشروع Sc2.0 هو التوليف الكامل لجينوم مصمم خصيصًا لكائن نموذج حقيقي النواة ليكون بمثابة منصة للدراسات المنهجية للكروموسومات حقيقية النواة. يتم توزيع الجهد العالمي Sc2.0 لبناء الكروموسومات عبر العديد من المواقع. حفز هذا الجانب الفريد من Sc2.0 تصميم جوانب برنامج BioStudio التي تمكن من استراتيجية تجميع مشتركة وفرض لغة مشتركة لوصف كل من الكروموسومات الوسيطة المصممة والسلالات الحية.

نقطة البداية لتسلسل الجينوم Sc2.0 هي المنسقة للغاية خميرة الخميرة تسلسل (1, 2). توازن المبادئ التوجيهية لتصميم الجينوم Sc2.0 الرغبة في الحفاظ على النمط الظاهري "من النوع البري" مع إدخال المرونة الوراثية المحفزة وتقليل مصادر عدم الاستقرار الجيني الناتج عن الطبيعة المتكررة للحمض النووي للخميرة الأصلية. لذلك تم تصميم كروموسومات Sc2.0 لتشفير كود جيني معدل بشكل طفيف يتم فيه تغيير جميع أكواد التوقف TAG إلى TAA (3) لتشمل مواقع loxPsym التي تدعم نظام التطور المحرض SCRaMbLE (4, 5) وبسبب نقص العناصر المتكررة ، يتم نقل جينات RNA (التي تم نقلها إلى "الكروموسوم الجديد") والعديد من الإنترونات. علاوة على ذلك ، فإن التسلسلات القصيرة المعاد ترميزها داخل إطارات القراءة المفتوحة (ORFs) ، والتي تسمى PCRTags ، تسهل إجراء اختبار قائم على تفاعل البلمرة المتسلسل (PCR) للتمييز بين النوع البري والحمض النووي الاصطناعي (57). أخيرًا ، تقوم البدائل الأساسية داخل ORFs بإدخال أو إزالة مواقع التعرف على الإنزيم لتسهيل تجميع الكروموسومات الاصطناعية.

لتنفيذ إعادة تصميم Sc2.0 على نطاق واسع للجينوم ، كان من الضروري إنشاء ليس فقط خط أنابيب تجميع DNA عام لكروموسومات تركيبية بحجم 200 كيلو بايت إلى و GT1 ميجا بايت ولكن أيضًا أدوات حسابية مرنة. لقد أكملنا الآن تصميم جينوم Sc2.0 ووصف الجهد هنا. حتى الآن ، تم بناء 6.5 كروموسومات مصممة في سلالات منفصلة (5, 813) ، وهنا نظهر دمج 2.5 من الكروموسومات الاصطناعية في سلالة واحدة. تتوافق الأنماط الظاهرية القريبة من النوع البري للسلالات الاصطناعية مع التسامح الواسع النطاق لخصائص المصمم وتشير إلى المتانة الكلية S. cerevisiae للتلاعب الجيني.


بناء الأليلات الطافرة

توفر الخميرة المتوافقة مع البشر سياقًا مبسطًا لتحليل وظيفة الجينات البشرية التي تكون قابلة بشكل خاص للنهج المنهجية وعالية الإنتاجية. للاستفادة من النظام المتوافق مع البشر ، من الضروري وجود مصادر أليلات مثيرة للاهتمام للجينات البشرية. ركزت المناهج الأولية على الأليلات المعروفة المتعلقة بالأمراض البشرية ولكنها توسعت مؤخرًا لتشمل "متغيرات مجهولة الأهمية" وجميع بدائل الأحماض الأمينية الممكنة. تسمح تقنية المسح الطفري العميق التي ابتكرها Fowler and Fields (14) بتوليد أليلات استبدال الأحماض الأمينية المفردة بأعلى كثافة ممكنة. عند الاتصال بمقايسات النمط الظاهري ، يكشف المسح الطفري العميق عن الأليلات الطافرة بالخصائص المرغوبة ، وعادةً ما يكون نوعًا من فقدان الوظيفة. حمزة وآخرون (5) شاشة FEN1 الأليلات التي تم تصميمها لتعطيل التحفيز ولكن ليس ربط الحمض النووي ، وبالتالي كان من المحتمل أن تؤدي إلى محاصرة معقدات FEN1-DNA. يمكن استخدام المسح الطفري العميق لفصل الطفرات الوظيفية التي تفقد النشاط التحفيزي ولكنها تحافظ على تفاعلات البروتين والحمض النووي والبروتين والبروتين (15) ، وهو بالضبط نوع المسوخ المحاصر الذي قام به حمزة وآخرون. نموذج معهم FEN1 الأليلات.


بيولوجيا أنظمة الخميرة: أفضل ما لدينا في نمذجة خلية

تعترف جائزة إدوارد نوفيتسكي من جمعية علم الوراثة الأمريكية بالمستوى غير العادي للإبداع والبراعة الفكرية في حل المشكلات المهمة في أبحاث علم الوراثة. صعد المتلقي لعام 2014 ، تشارلز بون ، إلى قمة الانضباط الناشئ لبيولوجيا أنظمة ما بعد الجين من خلال التركيز على رسم الخرائط العالمية لشبكات التفاعل الجيني. اخترع بون تقنية المصفوفة الجينية الاصطناعية (SGA) ، والتي توفر طريقة آلية لعبور آلاف السلالات التي تحمل طفرات دقيقة ورسم خريطة للتفاعلات الوراثية للخميرة على نطاق واسع. تقدم خرائط الشبكة هذه للباحثين مخططًا وظيفيًا للأسلاك للخلية ، والذي يجمع الجينات في مسارات محددة ويكشف عن الاتصالات الوظيفية.

من الآمن أن نقول إن الخميرة مفهومة بشكل أفضل من أي خلية أخرى. تدرس المئات من المختبرات في جميع أنحاء العالم هذا النموذج الجيني القوي من وجهات نظر مختلفة منذ عقود ، وقد حققنا تقدمًا مذهلاً في فهم معظم المسارات والوظائف الخلوية. ومع ذلك ، لا أحد منا يدعي أنه يعرف كيف تعمل خلية الخميرة حقًا.

المشكلة الرئيسية هي أن الكتلة المتزايدة باستمرار من المعلومات البيولوجية التفصيلية لم يتم تجميعها في صورة كاملة ومتكاملة. في النهاية ، إذا أردنا صياغة نموذج للحياة على مستوى الخلية الكاملة ، يجب أن نفهم كيف ترتبط جميع مكوناتها وتنسيقها. عندها فقط سنكون قادرين على التنبؤ بالاستجابات الفسيولوجية لاضطراب وراثي أو بيئي معين. على الرغم من أنها مهمة شاقة ، أعتقد أن نمذجة الخلية في متناول أيدينا ، وعلى الرغم من أنني قد أكون متحيزًا ، أعتقد أن الخميرة الناشئة تقدم أفضل فرصة لتحقيق هذا التحدي.

اتخذ فريق Andre Goffeau الدولي الخطوة الأولى نحو فهم شامل للخلية ، حيث قام بتجميع التسلسل الأول لحقيقة النواة (Goffeau وآخرون. 1996). فتح الحصول على صورة كاملة لجينوم الخميرة الباب أمام مناهج الجينوميات الوظيفية التي بالكاد يمكن تخيلها في السابق. كزميل ما بعد الدكتوراه في جامعة أوريغون ، أتذكر أنني شعرت بالذهول لما بدا آنذاك فكرة جامحة تمامًا. خلال العشاء ، وصف المتحدث الزائر ، ستان فيلدز ، كيف كان يخطط لاستنساخ كل جين خميرة في محاولة لاختبار جميع أزواج بروتين الخميرة الممكنة ، والتي تغطي مصفوفة 6000 × 6000 بأكملها ، للتفاعلات الفيزيائية باستخدام اختباره ثنائي الهجين (Uetz) وآخرون. 2000). في الوقت نفسه ، هناك عدة مجموعات خميرة مختلفة ، وكلاهما أكاديمي (Derisi 1997 Eisen وآخرون. 1998) والشركات التجارية (Dimster-Denk وآخرون. 1999 هيوز وآخرون. 2000) ، كانت رائدة في تحليل التعبير الجيني على مستوى الجينوم للكشف عن استجابات النسخ العالمية. وفي الوقت نفسه ، تم تمكين الشاشات المظهرية المنهجية من خلال مجموعات متحولة على نطاق الجينوم ، تم تجميعها في شكل مكتبات طفرات ترانسبوسون (روس-ماكدونالد) وآخرون. 1999) وحذف المجموعات (Winzeler وآخرون. 1999 جيايفر وآخرون. 2002). مجتمعة ، قدمت هذه الأساليب على مستوى الأنظمة طريقة متكاملة جديدة للتفكير في العلوم ، طريقة ألهمت الشكل الآلي لعلم الوراثة الخميرة الذي يسمى تحليل المصفوفة الجينية الاصطناعية (تونغ). وآخرون. 2001) ، وهي منهجية مصممة لرسم خريطة للتفاعلات الجينية على نطاق الجينوم (تونج وآخرون. 2004).

إن تسخير خبرة وقوة مجتمع أبحاث الخميرة بأكمله بطريقة منسقة سيمثل نسخة بيولوجيا نهج مستوى الأنظمة النهائية لعلم متطور يشبه CERN.

—C.B.

يعتمد النجاح في علم الجينوم الوظيفي على فرق متعددة التخصصات يمكنها تصميم وتنفيذ وتفسير استراتيجيات تجريبية واسعة النطاق. جزء لا يتجزأ من هذه العملية هو التحليل الحسابي المطلوب لمعالجة وتحديد البيانات الناشئة. أعتقد أن ثقافة مجتمع الخميرة للمشاركة المفتوحة للكواشف والأفكار قد أعدتنا جميعًا لاحتضان هذا النمط الجديد من العلوم التعاونية على نطاق واسع. تطوير السكريات لعبت قاعدة بيانات الجينوم (SGD) (Cherry 1998) أيضًا دورًا مهمًا في بناء ثقافة الوصول المفتوح هذه من خلال تجميع البيانات وتنظيمها من كل من الدراسات المركزة والواسعة النطاق. من خلال فريق الخبراء التابع لها ، تقوم SGD أيضًا برعاية البيانات المستمدة بشكل أساسي من الدراسات المركزة لإنشاء تعليقات توضيحية في علم الوجود الجيني (GO) يمكن قراءتها آليًا لجينات الخميرة (Ashburner وآخرون. 2000). في حين أن هذا التعليق التوضيحي المفصل ضروري لتوصيل فهمنا لوظيفة الجينات ، فإنه يوفر أيضًا معيارًا ذهبيًا لتقدير المعلومات الوظيفية المستمدة من الدراسات واسعة النطاق ، والتي قد تختلف في الجودة والاتساع. وهكذا ، فإن SGD يسد الفجوة بين الدراسات عالية الدقة ، ولكن المنحازة ، والمركزة ، والدراسات العالمية ، مع إمكانية واسعة لمعالجة أدوار الجينات غير المميزة سابقًا ورسم خريطة روابط وظيفية جديدة بين العمليات التي تبدو غير مرتبطة.

على وجه التحديد ، نظرًا لأنه ينسق جميع بيانات تجارب الخميرة ويجعلها متاحة بشكل عام ، فقد أصبح SGD هو حجر الزاوية في مجالنا. ربما الأهم من ذلك ، من خلال SGD ، أن مجتمع الخميرة قد رسم نموذجًا ناجحًا للغاية لمعالجة التعليق التوضيحي الوظيفي للجينوم. في الواقع ، إذا كنت أقوم بتوجيه مصادر التمويل الرئيسية ، فسوف أستثمر بكثافة في تنفيذ استراتيجية SGD مماثلة للجينوم البشري (بمعنى آخر.، HGD). بعد أن زرت موقع SGD على الويب كل يوم تقريبًا منذ إنشائه ، لا يمكنني إلا أن أتخيل أن نظير HGD سيكون له تأثير لا يُقاس على علم الوراثة البشرية وفهمنا للجينوم البشري.

في أعقاب الأزمة المالية الأخيرة ، قلصت حكوماتنا تمويل العلوم الأساسية ، وللأسف ، فإن دعم مشروع مثل HGD غير مرجح. ومن المفارقات ، أنه في الوقت الذي بدأنا فيه إحراز تقدم حقيقي نحو فهم آلي لكيفية عمل الحياة ، تتقلص الموارد المخصصة للبحث الأساسي. مع وضع هذا في الاعتبار ، يبدو من الواضح أن HGD سوف تتناسب بدقة مع محفظة شركة المعلومات الخاصة. لا بد أن يكون تجميع HGD مربحًا لأنه يشكل أساسًا للطب الدقيق. في الماضي ، كنا جميعًا قلقين بشأن مصالح الشركات التي تمتلك تسلسل الجينوم البشري ، ومن المفارقات ، يبدو أنه في بيئة اليوم ، قد يكون القطاع الخاص أملنا الوحيد في تمويل مشروع مثل HGD.

أتاح تحليل الشبكة الجينية SGA لمجموعة البحث لدينا فرصة للتفاعل مع SGD و BioGRID (Stark وآخرون. 2006) ، وقواعد البيانات الأخرى للمساهمة في الشرح الوظيفي لجينوم الخميرة. لقد عملت أنا وبريندا أندروز ومايكل كوستانزو معًا لتجميع وتنفيذ المنهجية والكواشف اللازمة لتعيين شبكة تفاعل جيني كاملة للخميرة. إن المتعاونين الرئيسيين في مجال الحوسبة لدينا ، تشاد مايرز وفريقه ، مسؤولون إلى حد كبير عن معرفة كيفية استخراج معلومات ذات مغزى من مجموعة البيانات واسعة النطاق ، ولكنها صاخبة نسبيًا. من خلال تحليل SGA ، نحدد التفاعلات الجينية السلبية والإيجابية ، حيث يتم تسجيل الطفرات المزدوجة على أنها تنمو بشكل أسوأ أو أفضل مما هو متوقع ، على التوالي (Baryshnikova وآخرون. 2010). إن تجميعنا لشبكة وراثية عالمية مكونة من مئات الآلاف من التفاعلات الجينية يسلط الضوء على قوة الجينات التوافقية في تحديد المسارات ، وتحديد كيفية عملها معًا للتحكم في الوظائف الخلوية الأساسية ، ورسم خرائط لمخطط الأسلاك الوظيفية للخلية (كوستانزو) وآخرون. 2010).

منذ أكثر من 10 سنوات ، اقترح لي هارتويل وزملاؤه أن التفاعلات الجينية قد تلعب دورًا رئيسيًا في قدرتنا على تفسير العلاقة بين النمط الجيني والنمط الظاهري للفرد (هارتمان). وآخرون. 2001). تكتسب هذه الفكرة الآن قوة جذب مع كل من الخميرة (Bloom وآخرون. 2013) وعلماء الوراثة البشرية (Zuk وآخرون. 2012) ومن المرجح أن تصبح أكثر وأكثر صلة بالتسلسل الوشيك لملايين الجينوم البشري الفردي. في حين أنه لا يزال يتعين إثباته ، نظرًا لنطاق واتساع الشبكة الوراثية العالمية للخميرة ، يمكننا بالتأكيد أن نتوقع أن التفاعلات الجينية وشبكاتها يجب أن تكمن وراء نسبة كبيرة من الأنماط الظاهرية للأمراض البشرية. لحسن الحظ ، هناك بعض القواعد البسيطة المرتبطة بهيكل وطوبولوجيا الشبكات الجينية التي يبدو أنها محفوظة بشكل عام. على وجه الخصوص ، غالبًا ما تتصرف الجينات الموجودة في المسارات بطريقة متماسكة ، مرتبطة بمسارات أخرى من خلال مجموعة متسقة من التفاعلات الإيجابية أو السلبية. في الواقع ، من خلال استقراء هذه القواعد من الشبكة الجينية للخميرة ، يبدو أن فريق تشاد الحسابي قد طور طرقًا تتمتع بقوة إحصائية كافية لاكتشاف إشارات التفاعل الجيني المهمة من دراسات الارتباط على مستوى الجينوم (GWAS) في البشر. وبالتالي ، فإن الخصائص الأساسية للشبكات الجينية التي نتعلمها من الخميرة قد تكون حاسمة في تفسير الجينوم الخاص بنا.

أثبتت الأساليب التي ابتكرها تشارلي بون أنها أغنى مصدر للتفاعلات البيولوجية المعروفة حتى الآن ، وهي أساسية لـ "التفاعلات" التي تقود الكثير من التجارب الجينية والفكر المعاصر.

—جاسبر راين ، جامعة كاليفورنيا ، بيركلي

غذت التقنيات على مستوى الأنظمة التي تم تطويرها في الخميرة وبيانات مقياس الجينوم الناتجة مجال المعلوماتية الحيوية وعلم الأحياء الحسابي. في الواقع ، فقط من خلال المعالجة الحسابية التفصيلية لبيانات الجينوميات الوظيفية يمكننا أن ندرك إمكاناتها الكاملة. ومع ذلك ، لبناء نموذج دقيق وشامل للخلية ، يجب أن نستمر في دفع حدود كل من الجينوميات الوظيفية والمعلوماتية الحيوية الخاصة بها. أعتقد أن الخطوة التالية تتطلب وضعًا عمليًا جديدًا حيث يتم جمع البيانات على مستوى المجتمع بدلاً من المعامل الفردية. نظرًا لأن جميع مؤسسات البحث لدينا تعمل على نفس الخلية بالضبط ، فإن هذا المستوى التالي من العلوم عالية التنسيق أمر ممكن تمامًا. توفر لنا سلالتنا المرجعية ، S288c ، الاستمرارية الجينية ، مما يعني أنه يمكن تجميع بيانات مقياس الجينوم الكمي المستمدة من مختبرات مختلفة في جميع أنحاء العالم وتجميعها في تنسيق موحد. بالنظر إلى أن كل مختبر لديه خبرة في مسارات محددة وبالتالي يمكنه تصميم قراءات رائعة خاصة بالمسار ، فإن مجتمعنا لديه القدرة على تنسيق تحليل كمي لمعظم المسارات تحت تأثير مجموعة الجينوم الواسعة من الاضطرابات الجينية ومجموعة موحدة من البيئة. شروط. ليس من الواضح بالضبط كيفية القيام بذلك ، لكنني أظن أن هذا النمط من التحليل يمكن تحقيقه من خلال عدد من الأنواع المختلفة من التجارب ، يتضمن أحد الأساليب الواضحة الجمع بين جينات خميرة SGA الآلية وفرز الخلايا أو الفحص عالي المحتوى لتحديد نشاط مراسلي التشخيص في مجموعة شاملة من المسوخ (Jonikas وآخرون. 2009 فيزيكومار وآخرون. 2010). على الرغم من أنه سيكون هناك بالتأكيد تحديات تقنية يجب التغلب عليها ، فإن تسخير خبرة وقوة مجتمع أبحاث الخميرة بأكمله بطريقة منسقة سيمثل نسخة بيولوجيا نهج مستوى الأنظمة النهائية لعلم متطور يشبه CERN.

لقد قطع مجال بيولوجيا أنظمة الخميرة شوطًا طويلاً (Botstein and Fink 2011) ، ولكن ربما حان الوقت الآن لاتخاذ الخطوة الكبيرة التالية. يجب أن يكون مجتمع الخميرة قادرًا على تقديم نوع البيانات التي يحتاجها كل من علماء الأحياء والمنظرين لتحقيق نمذجة خلية حقيقية النواة.


النتائج

F1- تم اختراق نشاط ATPase في yme1 الخلايا: yme1 تنمو الخميرة ببطء شديد في حالة عدم وجود الحمض النووي المتقدري. يتم تسجيل هذا النمط الظاهري بسهولة عن طريق استنبات الخلايا في وجود بروميد الإيثيديوم ، مما يتسبب في فقدان كمية mtDNA من الخلايا (S lonimski وآخرون. 1968 F الثور وآخرون. 1991). حددنا الطفرات السائدة في اثنين من F1 الوحدات الفرعية، ATP1-75 و ATP3-1، الذي يقمع هذا النمط الظاهري السلبي الصغير من yme1 سلالات (الشكل 1 W eber وآخرون. 1995 K ominsky و T حصان 2000). في ضوء هذه الملاحظة ، قمنا بفحص F1F0- نشاط ATPase في الميتوكوندريا المعزولة من النوع البري ، yme1، و yme1 سلالات تحمل مثبطات النمط الظاهري السلبي الصغير. تم فحص الميتوكوندريا من السلالات التي تحتوي على جينوم ميتوكوندريا سليم (ρ +) ومن السلالات التي تفتقر إلى mtDNA (ρ °) في وجود وغياب أوليغوميسين ، وهو مثبط لـ F مقترن.1F0نشاط قاعدة ATPase. كما هو مبين في الشكل 2 أ ، فإن نشاط ATPase في الميتوكوندريا yme1 ρ + الخلايا أقل بنسبة 15٪ من الخلايا في النوع البري. في المقابل ، قمعت yme1 ATP1-75 و yme1 ATP3-1 أظهرت السلالات زيادة ملحوظة في مستوى نشاط ATPase في الميتوكوندريا ، أعلى بنسبة 20٪ من النوع البري. بالإضافة إلى ذلك ، كان نشاط ATPase الكلي للميتوكوندريا في السلالات المكبوتة أقل حساسية للأوليغوميسين. نشاط ATPase المنفصل ، F1-ATPase ، كان أكبر مرتين في yme1 سلالات الخميرة التي تحمل ATP1-75 أو ATP3-1 من الطفرات غير المكبوتة yme1 أضنى.

- قمع yme1 النمط الظاهري السلبي الصغير. تم وضع السلالات المشار إليها على لوحة جلوكوز اصطناعية إما تفتقر إلى (A) أو تحتوي على (B) 25 ميكروغرام / مل من بروميد الإيثيديوم وتم تحضينها لمدة 5 أيام عند 30 درجة. يؤدي نمو الخميرة في وجود بروميد الإيثيديوم إلى الفقد الكمي لـ mtDNA (S lonimski وآخرون. 1968 F الثور وآخرون. 1991). كانت السلالات كالتالي: yme1Δ ، PTY52 ATP1-75 yme1Δ ، PTY93 ATP3-1 yme1Δ ، PTY109 atp4Δ ، DKY40 atp7Δ ، DKY44 atp4Δ yme1Δ ، DKY48 atp7Δ yme1Δ ، DKY50 والنوع البري ، PTY44.

—نشاط قاعدة ATPase في yme1 خميرة. تم فحص خمسة ميكروغرامات من الميتوكوندريا المعزولة من السلالات المشار إليها ρ + (A) أو ° (B) في ثلاث نسخ. البيانات تعني +/- الخطأ المعياري للمتوسط. تم تحضين التفاعلات بدون (-) أو مع (+) أوليغوميسين (2 ميكروغرام / مل) لتحديد نسبة نشاط ATPase المثبط. يتم التعبير عن النشاط المحدد لـ ATPase كـ [micromoles of صأنا في الدقيقة لكل ميكروجرام من البروتين (× 1000)]. كانت السلالات كالتالي: yme1، PTY52 yme1 ATP3-1، PTY109 yme1 ATP1-75، PTY93 والنوع البري ، PTY44.

لأن yme1 لا تنمو الخميرة ρ ° جيدًا بما يكفي للسماح بتراكم خلايا ° درجة للتحليل الكيميائي الحيوي ، فقد ابتكرنا مخططًا للحث بسرعة على فقدان mtDNA من مزارع الخميرة ρ + بإضافة 25 ميكروغرام / مل من بروميد الإيثيديوم (المواد والطرق) . أنتج هذا العلاج و GT90 ٪ من بيتيت السيتوبلازم دون تراكم كبير من الكابتات خارج الجين. قمنا بتقييم نشاط ATPase للميتوكوندريا و F.1- نشاط قاعدة ATPase من النوع البري ، yme1، وقمعها yme1 سلالات صغيرة السيتوبلازم أعد بهذه الطريقة (الشكل 2 ب). بالنسبة لجميع السلالات ، لم يتغير نشاط ATPase الكلي للميتوكوندريا لخلايا ρ ° بشكل أساسي عن نشاط الخلايا المقابلة ρ +. نسبة F غير حساسة للقليوميسين1ومع ذلك ، كان نشاط ATPase مختلفًا بشكل كبير في الخلايا ρ + و °. عادة ، في مجتمع الخلايا المتجانسة ° ° ، يكون نشاط ATPase للميتوكوندريا غير مرتبط وبالتالي قليل الحساسية من oligomycin بسبب عدم وجود F كامل.0 مركب. لوحظ هذا إلى حد كبير في الخلايا البرية ρ ° المحضرة من المعالجة الدفعية ببروميد الإيثيديوم ، حيث يكون 66 ٪ من نشاط ATPase غير حساس للأليغوميسين ، مقارنة بـ 15 ٪ في الخلايا +. من المحتمل أن يعكس نشاط ATPase المتبقي الحساس للأوليغوميسين في الخلايا البرية ρ ° إنتاجًا غير مكتمل لخلايا ρ ° (ما يصل إلى 10 ٪ من الخلايا كانت ρ + في الثقافات المعالجة بالإيثيديوم-بروميد) ووجود البروتينات المتبقية المشفرة بالميتوكوندريا الحفاظ عليها خلال نمو الثقافات المعالجة بالإيثيديوم بروميد. على عكس النوع البري ، فإن 40٪ فقط من نشاط ATPase في yme1 ρ ° الميتوكوندريا غير حساسة للأليغوميسين. هذا يشير إلى أن نسبة كبيرة من F.1 المركب لا يزال مقترنًا بـ F.0 الوحدات الفرعية في yme1 خميرة. أنشطة ATPase في الميتوكوندريا في yme1 ρ ° الخلايا التي تحمل طفرات قمعية في ATP1 و ATP3 هي ، كما هو الحال في سلالات ρ + ، أعلى بكثير من تلك الموجودة في النوع البري أو yme1 خميرة. غالبية نشاط ATPase في هذه المكبوتة yme1 السلالات غير حساسة للقليوميسين F1-ATPase النشاط ، كما كان صحيحًا بالنسبة للنوع البري.

—كمية Atp1p و Atp2p في النوع البري و yme1 خميرة. (أ) الكشف المناعي لبروتينات الميتوكوندريا. تم حل ما يقرب من 15 ميكروغرام من الميتوكوندريا من السلالات المشار إليها في تغيير طبيعة هلام بولي أكريلاميد 7.5 ٪. تم نقل البروتينات إلى النيتروسليلوز وفحصها بالأجسام المضادة ضد الوحدتين الفرعيتين ألفا وبيتا من F1F0-ATPase (Atp1p و Atp2p ، على التوالي) و Arg8p ، وهو بروتين موجود في مصفوفة الميتوكوندريا. (ب) التركيز النسبي لـ Atp1p و Atp2p في النوع البري و yme1 خميرة. تم ترقيم البقعة الموجودة في A وتقدير الإشارات النسبية باستخدام برنامج Molecular Analyst من Bio-Rad. للتحكم في الاختلافات في تركيز العينة ، تمت تسوية المقدار النسبي لـ Atp1p و Atp2p في كل حارة إلى مقدار Arg8p. تم ضبط تركيزات النوع البري لـ Arg8p و Atp1p و Atp2p على 100. السلالات: النوع البري ، PTY44 yme1، PTY52 yme1 ATP1-75و PTY93 و yme1 ATP3-1، PTY109.

انخفض F1F0نشاط قاعدة ATPase لـ yme1 قد تكون الخميرة نتيجة لانخفاض مستويات F1F0- مركب ATPase ، وزيادة تثبيط ف1F0-ATPase ، أو مزيج من الاثنين. وبالمثل ، فإن زيادة F1F0- نشاط ATPase للسلالات المكبوتة (yme1 ATP1-75 و yme1 ATP3-1) قد يكون نتيجة للتغيرات في بنية البروتين التي تزيد من النشاط ، وزيادة في تراكم F1F0-ATPase بروتين أو مزيج من الاثنين. وبالتالي ، فإن مقدار F1F0- تم تحديد الوحدات الفرعية ATPase α (Atp1p) و β (Atp2p) باستخدام الكشف المناعي لمستخلصات بروتين الميتوكوندريا المرتبطة بالنيتروسليلوز (الشكل 3). لمقارنة تركيز Atp1p و Atp2p الموجود في كل سلالة ، تم تحديد التركيز النسبي لبروتين ميتوكوندريا غير ذي صلة ، Arg8p ، واستخدامه لتصحيح الاختلافات في تركيز العينة (الشكل 3 ب). في ρ + خلايا ، yme1 تحتوي خلايا الخميرة على انخفاض طفيف فقط في كمية Atp1p و Atp2 ، مما يشير إلى أن أساس نشاط ATPase المنخفض في yme1 يرجع سبب الميتوكوندريا إلى تثبيط نشاط الإنزيم. في المقابل ، كان هناك انخفاض ستة أضعاف في كمية Atp1p و Atp2p في yme1Δ ATP1-75 الخميرة على الرغم من أن هذه الخلايا تحتوي على 20٪ أكثر من F1F0-ATPase النشاط من النوع البري كان (الشكل 2 أ). وبالتالي ، فإن رقم دوران F1F0-ATPase فيما يتعلق بالتحلل المائي ATP في yme1Δ ATP1-75 تم زيادة الضغط و gt16 ضعفًا. وبالمثل ، فإن yme1Δ ATP3-1 أظهرت السلالة انخفاضًا طفيفًا في التركيز النسبي لـ Atp1p وبالتالي زيادة متواضعة في رقم دوران ATPase ، أكبر بثلاثة أضعاف تقريبًا من النوع البري F1F0-ATPase.

—تراكم F0 الوحدات الفرعية في yme1 خميرة. تم حل خمسة عشر ميكروغرامًا من الميتوكوندريا من السلالات المشار إليها على هلام بولي أكريلاميد 12 ٪ تغيير طبيعة. تم نقل البروتينات إلى النيتروسليلوز وفحصها بالأجسام المضادة ضد Atp4p (anti-su 4) و Atp7p (anti-su 7). (أ) ρ + ميتوكوندريا. (ب) ρ ° الميتوكوندريا. السلالات: بالوزن ، PTY44 yme1، PTY52 yme1 ATP3-1و PTY109 و yme1 ATP1-75، PTY93.

F0 تتراكم الوحدات الفرعية في yme1 ρ ° الخلايا: أظهر العمل السابق أن أيا من F1 الوحدات الفرعية ، Atp3p و Atp1p ، يتم تسليمها بطريقة تعتمد على Yme1p (W eber وآخرون. 1995). بالإضافة إلى ذلك ، فإن وجود نسبة أعلى من المعتاد من نشاط ATPase الحساس للأليغوميسين في yme1 ρ ° خميرة تشير إلى أن F1 المركب في تلك الميتوكوندريا قد لا يزال يتفاعل مع F0 الوحدات الفرعية. لذلك ، قمنا بفحص مصير ف0 الوحدات الفرعية في yme1 الخلايا. تم إجراء تجارب الكشف المناعي باستخدام الأجسام المضادة متعددة النسيلة الموجهة ضد Atp4p و Atp7p ، وهما وحدتان فرعيتان من F0 مركب. كما هو مبين في الشكل 4 أ ، لا يوجد فرق في تركيزات هذه البروتينات في ρ + الميتوكوندريا المعزولة من النوع البري ، yme1، أو مكبوتة yme1 خميرة. ومع ذلك ، يتراكم كل من Atp4p و Atp7p في ملفات yme1 ρ ° الخميرة وكذلك في yme1 ATP1-75 و yme1 ATP3-1 المسوخ (الشكل 4 ب). لاحظ باحثون آخرون معدل دوران F المعتمد على Yme1p0 الوحدات الفرعية 4 و 5 و 6 و 17 بوصة oxa1Δ سلالات الخميرة (L. emaire وآخرون. 2000).

- توليد جهد غشاء ميتوكوندريا داخلي بإضافة السكسينات في ρ + الخميرة. ρ + تم عزل الميتوكوندريا من النوع البري ، yme1، وقمعها yme1 ATP3-1 و yme1 ATP1-75 خميرة. يتم التعبير عن الامتصاص المعتمد المحتمل لـ 3،3′-dipropylthiocarbocyanine iodide كنسبة مئوية من التألق النسبي. يشار إلى النقطة الزمنية لإضافة tris-succinate بواسطة S ، والنقطة الزمنية لإضافة سيانيد الكربونيل المنفصل م- يشار إلى كلوروفينيل هيدرازون بواسطة C. سلالات: البرية من النوع ρ + ، PTY44 yme1 ρ + ، PTY52 yme1 ATP3-1 ρ + و PTY109 و yme1 ATP1-75 ρ + ، PTY93.

To determine whether the accumulation of Atp4p or Atp7p was the basis for the abnormally high proportion of oligomycin-sensitive ATPase activity of yme1 ρ° yeast, we tested whether a null mutation in ATP4 و / أو ATP7 suppressed the yme1 petite-negative phenotype. Neither the atp4Δ yme1 و ال atp7Δ yme1 double mutants (Figure 1) nor the atp4Δ atp7Δ yme1 triple mutant (data not shown) grew in the absence of mtDNA thus these mutations did not suppress the yme1 ρ° lethality. ال atp4Δ و atp7Δ mutants alone displayed no phenotype in the absence of mtDNA. It is possible that other F0 subunits may be involved in yme1 ρ° lethality, as four additional F0 subunits are encoded in the nucleus. Alternatively, accumulation of F0 subunits in yme1 yeast may be a separate phenomenon from that of the petite-negative phenotype of these cells.

The inner mitochondrial membrane potential is diminished in yme1 yeast: Inactivation of ATP synthase F1 subunits coupled with the loss of mtDNA results in a decrease of the inner mitochondrial membrane potential (G iraud and V elours 1997). Because the petite-negative phenotype of yme1 yeast can be rescued by mutations in two F1 proteins, we examined the membrane potential in yme1 الخلايا. Changes in the membrane potential of mitochondria isolated from ρ + yeast in response to the addition of succinate were monitored by measuring the uptake of the fluorescent dye 3,3′-dipropylthiocarbocyanine iodide. These changes were recorded after the addition of a substrate, tris-succinate, and after the addition of an uncoupler, carbonyl cyanide م-chlorophenylhydrazone. Mitochondria prepared from the yme1 ρ + , yme1 ATP3-1 ρ + , and yme1 ATP1-75 ρ + mutant strains all exhibit a reduction of membrane potential relative to wild type as judged by the relative change in fluorescence upon addition of the uncoupler (Figure 5).

The ability to generate a membrane potential in response to succinate is dependent upon electron transport, a feature absent in ρ° cells. Instead, the generation of membrane potential in ρ° mitochondria is created by the flux of ATP and ADP through the ATP/ADP translocator (G iraud and V elours 1997). Consequently, we examined the ability of wild-type and mutant yeast strains to generate a membrane potential using ATP by monitoring fluorescence of rhodamine 123 (Figure 6). Wild-type ρ + and ρ° mitochondria generated a membrane potential in response to added ATP, as indicated by the decrease in relative fluorescence (Figure 6A). The membrane potential was destroyed by the addition of the ionophore valinomycin, and the magnitude of the membrane potential can be judged by the relative change in fluorescence that occurred in response to addition of valinomycin. The greater membrane potential in ρ + as compared to that of ρ° mitochondria is probably a reflection of both the flux of ATP/ADP through the translocator and the ability to pump protons out of mitochondria upon ATP hydrolysis by the F1F0-ATPase. اللافت للنظر ، yme1 mitochondria, whether ρ + or ρ°, did not generate a membrane potential in response to the addition of ATP, and the small potential present before the addition of ATP was actually destroyed (Figure 6B) by the addition of ATP. Mitochondria prepared from ρ + and ρ° yme1 strains bearing a suppressing mutation in the α-subunit of ATP synthase (yme1 ATP1-75 strains) once again generated a membrane potential in response to ATP (Figure 6C). The ρ° mitochondria from wild-type or yme1 ATP1-75 yeast, whether prepared from clonal ρ° cultures (Figure 6C) or from ρ + strains treated with ethidium bromide (data not shown), generated a membrane potential in response to ATP. Hence, the petite-negative phenotype of yme1 yeast is likely due to the inability of the mitochondria to generate a membrane potential in response to ATP.

—Generation of an inner mitochondrial membrane potential in ρ + and ρ° yeast by addition of ATP. Mitochondria were isolated from wild-type, yme1، و yme1 ATP-75 خميرة. The ρ° mitochondria prepared from wild-type and yme1 ATP1-75 strains are quantitatively ρ°. The ρ° mitochondria prepared from the yme1 strain were generated from a batch culture of ρ + cells by treatment with ethidium bromide. The potential dependent quenching of rhodamine 123 fluorescence is expressed as percentage of relative fluorescence. ATP was added at ∼240 sec, and the ionophore valinomycin was added at ∼420 sec. Strains: wild-type ρ + , PTY44 wild-type ρ°, PTY44ρ° yme1 ρ + , PTY52 yme1 ρ°, PTY52ρ° yme1 ATP1-75 ρ + , PTY93 and yme1 ATP1-75 ρ°, PTY93ρ°.

حذف INH1 partially suppresses the petite-negative phenotype of yme1 ρ° cells: Mitochondrial ATPase activity in ρ° cells is necessary for the generation of a membrane potential in mitochondria (G iraud and V elours 1997). Since a yme1 strain has low ATPase activity compared to that of wild-type strains and since suppressing mutations of the α- and γ-subunits of F1-ATPase subunits lead to an increase in ATPase activity, it is possible that an inhibitor of F1-ATPase accumulates in yme1 سلالات. The accumulation of an F1-ATPase inhibitor might contribute to the ρ° slow-growth phenotype of the yme1 متحولة. Several small peptides encoded in the nucleus of yeast inhibit F1-ATPase activity. INH1 encodes an intrinsic F1F0-ATPase inhibitor (I chikawa وآخرون. 1990 Y oshida وآخرون. 1990). Inactivation of INH1 shows no phenotype in otherwise wild-type yeast and has been proposed to inhibit the F1F0-ATPase when the F1 و F0 portions of the ATPase are uncoupled. Inactivation of INH1 في yme1 background partially complemented the ρ° slow-growth phenotype (Figure 7). Two other nuclear genes, TIM11 و STF1, also affect F1F0-ATPase activity. TIM11 encodes a protein necessary for the assembly of F1F0-ATPase into dimers (A rnold وآخرون. 1998), and STF1 encodes a protein with sequence similarity to INH1 (A kashi وآخرون. 1988). When we tested whether a TIM11 deletion (Figure 7) or a STF1 deletion (data not shown) rescued the yme1 ρ° slow-growth phenotype, neither of these mutations, singly or in combination with each other or with inh1Δ, complemented the yme1 ρ° slow-growth phenotype (Figure 7 and data not shown). حذف INH1, TIM11، أو STF1 did not create a slow-growth phenotype in otherwise wild-type ρ° strains (Figure 7 and data not shown).

—Inactivation of an endogenous F1F0-ATPase inhibitor partially suppresses the yme1 ρ° slow-growth phenotype. The indicated yeast strains were cultured on (A) synthetic glucose media (SD) or (B) synthetic glucose media that contained 25 μg/ml ethidium bromide (SD + EtBr) for 5 days at 30°, creating ρ° strains. Strains: wild type, PTY44 inh1Δ, PTY190 tim11Δ, PTY191 inh1Δ tim11Δ, PTY192 yme1Δ, PTY52 yme1Δ inh1Δ, PTY193 yme1Δ tim11Δ, PTY194 and yme1Δ inh1Δ tim11Δ, PTY195.


مقدمة

While direct investigation of human biology can often be limited due to practical or ethical considerations, the wide array of model organisms available to researchers has allowed a remarkable amount of discovery into our own molecular functioning. All living organisms share commonalities in their underlying molecular makeup thus, knowledge of processes studied in one organism can often be translated to others. Eukaryotic microorganisms, with replication times and tractability akin to bacteria, but much more overlap in cellular components to humans, have proven especially useful in studying human biology. Chief among these, the budding yeast خميرة الخميرة has been an invaluable tool for uncovering much of the basic biology that underlies human cell functioning and disease.

The last common ancestor of humans and yeast is estimated to have lived approximately a billion years ago [ 1], and we still share a substantial portion of our genetic material. The human genome contains roughly 20 000 protein-coding genes while the yeast genome comprises about 6000. A pairwise comparison of genes between the species reveals ∼2100 groups of orthologs, representing 2300 yeast genes and 3900 human genes [ 2] ( Figure 1). Many shared genes perform important cellular roles in both organisms, and their perturbation leads to diverse human disorders, from cancer to Mendelian diseases. The homology between humans and yeast, and the inherent tractability of yeast, has enabled researchers to expand its usefulness as a model for human biology, both by heterologous expression of human proteins, as well as by directly modifying yeast cells to humanize specific amino acids, proteins or even entire yeast pathways ( Figure 2).

Humans and yeast share thousands of orthologous genes. The Venn diagram illustrates counts of human–yeast orthologs [ 2], grouped according to the nature of the orthology (classifying orthologs according to whether their count in humans:yeast is 1:1, many:1, or many:many) and whether the yeast genes are essential or not under standard laboratory growth conditions [ 3]. (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Humans and yeast share thousands of orthologous genes. The Venn diagram illustrates counts of human–yeast orthologs [ 2], grouped according to the nature of the orthology (classifying orthologs according to whether their count in humans:yeast is 1:1, many:1, or many:many) and whether the yeast genes are essential or not under standard laboratory growth conditions [ 3]. (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Five degrees of yeast humanization. Yeast have proven useful for the direct study of human biology in a variety of forms, illustrated here to distinguish those cases in which yeast were simply studied for human-specific processes and drugs (degree 0), to the heterologous expression of human genes in yeast (degree 1), all the way to the directed replacement of specific amino acids, genes, and pathways (degrees 2–4, respectively). (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Five degrees of yeast humanization. Yeast have proven useful for the direct study of human biology in a variety of forms, illustrated here to distinguish those cases in which yeast were simply studied for human-specific processes and drugs (degree 0), to the heterologous expression of human genes in yeast (degree 1), all the way to the directed replacement of specific amino acids, genes, and pathways (degrees 2–4, respectively). (A colour version of this figure is available online at: http://bfg.oxfordjournals.org)

Two early successes in humanization were demonstrated in 1985 and 1987 as a means of identifying human genes capable of rescuing yeast mutants: First, Kataoka وآخرون. [ 4] expressed chimeric yeast/human or full human RAS genes in yeast Δras mutants to demonstrate the functional homology retained between the two species. Next, in a famous and elegant experiment to identify human genes possessing the same function as fungal CDC2, Lee and Nurse [ 5] expressed a large library of human cDNAs in fission yeast (شيزوساكارومايس بومب), to identify an orthologous protein capable of rescuing a S. pombe Δcdc2 متحولة.

In the 30 years since these experiments, more than 400 yeast genes have been humanized [ 6–8]. Studies have ranged in their degree of direct translation to humans, from using yeast proteins to identify targets for human drugs to large-scale replacement of yeast genes with their human orthologs [ 9]. In this review, we discuss these ongoing efforts to develop and utilize humanized yeast, and their increased emphasis on high-throughput construction and applications. We consider five ‘degrees' of humanization, representing increasing levels by which the yeast have been altered to resemble the human case ( Figure 2).


المواد والأساليب

Strains and media

Yeast strains 779-6A (حصيرةأ, kar1-1, SUQ5, ade2-1, his3Δ202, leu2Δ1, trp1Δ63, ura3-52) (Jung and Masison, 2001 ) and W303 (حصيرةأ, ade2-1, ura3-1, his3-11, trp1-1, leu2-3, leu2-112, can1-100, GAL, SUC) (ATCC 208 352) were used. The 779-6A strain used throughout this study is [PSI + ], since it contained the prion form of the Sup35 protein. The W303 strain is used commonly in yeast research. HSP104 was deleted in strain 779-6A by transformation, using a PCR-amplified KanMX disruption cassette from a yeast deletion strain (ATCC) (Jones وآخرون., 2004 ). Yeast were grown at 30 °C in SD (synthetic defined Sunrise Science Products) medium containing 2% glucose, 7 g/l yeast nitrogen base (YNB Sunrise Science Products) and the appropriate complete supplement mixture (CSM) to maintain plasmid(s) selection. YPD medium contains 1% yeast extract, 2% peptone and 2% dextrose. 1/2YPD is similar to YPD but contains 0.5% yeast extract. The galactose medium contains 2% galactose and 2% raffinose in place of glucose. Cultures were maintained in log phase (OD600 < 0.6) by periodic dilution with fresh medium. بكتريا قولونية strain DH5α was used for plasmid propagation.

Plasmid constructions

HSP104 (position − 844 to + 2965) flanked by FRT sites was amplified from genomic DNA of S. cerevisiae strain 779-6A with the primer pair HSP104-1 (5′-ta ggatcc gaagttcctattctctagaaagtataggaacttcgactg ctcttgcacagaacctccc-3′) and HSP104-2 (5′-ta ctcgag gaagttcctatactttctagagaataggaacttcctttagttatcaacgcc atatgtccc-3′). The PCR product was digested with باممرحبا و زهوI and cloned in pRS314 to generate pC4F-HSP104. To construct pC4FURA3, Kpnأنا-Sacأنا URA3 (from − 225 to + 63) fragment flanked by 34 bp FRT was amplified by PCR from the plasmid pRS316 with the primer pair URA3–7 (5′-at gagctc gaagttcctattctctagaaagtataggaacttc gggccc ttttc aattcaattcatcatttttttt-3′) and URA3-8 (5′-at ggtacc ga agttcctatactttctagagaataggaacttc cggccg taataactgatat aattaaattga-3′), digested with Kpnأنا-SacI and inserted into the plasmid pRS314. ال اباأنا-لاأنا URA3 fragment in plasmid pC4FURA3 was replaced with اباأنا-EagI-digested m ulti- c loning s ite (MCS) from the plasmid pRS314 and this resulted in pC4FMCS. Plasmid pC4FGFP was constructed by inserting اباأنا-لاI fragment from pJ543 containing the ORF of GFP, which is under the control of SUP35 promoter (from − 600 to − 2), and fused to SUP35 terminator (182 bp of 3′ UTR), into the اباأنا-EagI-digested pC4FMCS. ORF الخاص بـ FLP was amplified from plasmid pTET23 (Park and Morschhauser, 2005 ) by using the primer pair FLP2 (tata ggatcc atgtcacaatttgatatattatgtaaaacacc) and FLP3 (tata cccggg ttatatgcgtctatttatgtaggatgaaag g), then inserted into زهوأنا-بامHI-digested GAL1 promoter fragment and Xmaأنا-SacI terminator fragment of HSP104 إلى زهوأنا-SacI-digested pRS315 to create pC5GAL1–FLP. Underlined sequences in the primers indicate the inserted restriction sites. All sequences have been verified. All the backbone plasmids have been described in detail (Sikorski and Hieter, 1989 ).

Determination of pre-excision rate under non-inducing conditions

To determine the [PSI + ]/[psi − ] phenotype, cells of the Δhsp104 [PSI + ] strain having plasmids pC4F-HSP104 and pC5GAL1–FLP were grown in SD—Trp—Leu drop-out medium to mid-log phase and then plated onto SD—Trp—Leu drop-out agar plate containing 10 µg/ml adenine. After 5 days of incubation at room temperature, the percentage of [psi − ] red colonies, which represents the pre-excision rate of HSP104, was determined. The determined data include some ‘spontaneous’ prion loss, whose frequency, determined by the strain having only pC4F-HSP104, was < 0.2%, could be due to increased Hsp104 in cells that have more than one copy of the plasmid.

Measurement of URA3 gene-flipping efficiency

Cells of strain 779-6A or W303 having plasmids pC4FURA3 and pC5GAL1–FLP grown in SD—Trp—Leu—Ura drop-out medium were transferred into similar SD-Trp-Leu medium with galactose in place of dextrose to induce Flp recombinase. During growth in galactose medium, aliquots of cells at the indicated generations (see Results), as determined by doubling of OD600, were plated onto both YPD and uracil drop-out agar plates. To calculate the number of cells per 1 ml culture, cells in the aliquot were counted using a cell-counting chamber (Neubauer, 0.0025 mm 2 ). After 3 days of incubation at 30 °C, the colonies were counted and the excision rate was calculated as colony number on uracil drop-out agar plates vs colony number on YPD plates, or the counted cell number.

التصوير

The GFP fluorescence in yeast was imaged using the Zeiss LSM510 confocal microscope with a × 63 objective. The same settings were used for imaging the GFP fluorescence in the different strains throughout the experiment.


Synopsis

A major goal of systems biology is to uncover the underlying structure of biological networks in order to develop comprehensive models of biological processes that are both accurate and predictive. In addition to genes that perform a single function, genetic networks also contain genes that perform many functions. To date, the network architecture of these multi-function or pleiotropic genes has not been well characterized. This study uses a combination of functional genomics and computational methods to reveal a non-trivial organization of highly pleiotropic genes in the important model organism S. cerevisiae.

Pleiotropy is a relatively common, but poorly understood phenomenon in biology defined as the ability of a mutation in a single gene to produce multiple effects في الجسم الحي. The prevalence of pleiotropy is perhaps most striking in the growing number of human diseases for which a mutation in a single gene produces a broad and seemingly unrelated set of symptoms ( Brunner and van Driel, 2004 ). In yeast, the availability of resources such as a complete set of isogenic deletion mutants ( Giaever et al., 2002 ) makes it possible to identify a comprehensive set of genes required for growth under a given environmental condition. To facilitate such genome-wide mutant analysis under a large number of conditions, we developed a cost-effective strategy to measure the growth of individual strains on standard agar plates. We used this method to assay the complete set of non-essential yeast gene deletions (4,700 mutants) under 21 environmental conditions in duplicate (>10 5 data points) and identified 216 highly pleiotropic mutants with growth defects in 3 or more conditions.Figure 6

It has long been hypothesized that pleiotropy, while frequently observed, poses significant disadvantages for the evolvability of an organism, including limiting the rate of adaptation and reducing the level of adaptation for some traits in response to selection for others ( Otto, 2004 ). By generating phenotype data for a relatively large number of conditions we were able to make an initial estimate of the overall degree of pleiotropy in yeast. We assessed the level of pleiotropy in our data by counting the number of phenotypes observed for each mutant. The results (Figure 8) show that approximately 70% of the mutants have a relatively low degree of pleiotropy, with phenotypes in only one or two conditions, and the remaining 30% are highly pleiotropic, with growth defects in as many as 14 conditions. To test the statistical significance of this amount of pleiotropy, we compared our data to a randomly generated distribution of phenotypes per mutant (Figure 8). A statistical comparison of these distributions demonstrates that the degree of pleiotropy we observe in an important model organism, خميرة الخميرة, is significantly greater than can be explained by chance. These results, support the hypothesis that pleiotropy plays an important role in biological systems.

Our work also yields a number of widely applicable technical advances that have the potential to meet one of the greatest challenges in understanding pleiotropic genes—determining whether the phenotypes associated with a mutation are the result of the loss of a single function or of multiple functions encoded by the same gene. In human disease research, understanding gene function at this level provides important information relevant for devising effective treatments and analyzing drug side-effects. Unfortunately, classical approaches for dissecting the behavior of pleiotropic genes, such as searching for multiple alleles of a gene that exhibit different phenotypes, are time-consuming and often not feasible in a clinical setting. To address this problem, we developed a method for determining the association between gene functions and mutant phenotypes based on a single mutant allele, such as a complete gene deletion.

The strong link between mutant phenotype and cellular function suggests that high throughput methods for measuring phenotypes may be used to identify such functions من جديد. In our study, we identified groups of mutants that shared a statistically significant set of phenotypes. The high degree of overlap between these clusters and known biological process annotations, synthetic lethal interactions, and protein complexes supported the hypothesis that this high throughput, unsupervised method can be used to discover genetically defined functional categories. Application of these functional predictions to the phenotype profiles of the highly pleiotropic mutants allowed us to generate hypotheses about the number of functions carried out by these genes and the conditions under which they are required (Figure 6). While extremely powerful in yeast, these methods hold even greater promise for analysis in organisms that are less genetically tractable, such as mammalian cell lines in which endogenous genes can be silenced using RNAi technology ( Schutze, 2004 ).


محتويات

S. cerevisiae (الخميرة) يمكن أن توجد بشكل ثابت إما ثنائي الصيغة الصبغية أو أحادي الصيغة الصبغية. تتكاثر كل من خلايا الخميرة أحادية الصيغة الصبغية ومزدوجة الصبغيات عن طريق الانقسام الفتيلي ، حيث تتبرعم الخلايا الوليدة من الخلايا الأم. الخلايا أحادية الصيغة الصبغية قادرة على التزاوج مع الخلايا أحادية الصيغة الصبغية الأخرى من نوع التزاوج المعاكس (an أ يمكن للخلية أن تتزاوج فقط مع خلية α ، والعكس صحيح) لإنتاج خلية ثنائية الصبغة مستقرة. يمكن للخلايا ثنائية الصبغية ، عادةً عند مواجهة ظروف مرهقة مثل استنفاد المغذيات ، أن تخضع للانقسام الاختزالي لإنتاج أربعة جراثيم أحادية الصيغة الصبغية: اثنتان من جراثيم ألفا واثنين من جراثيم ألفا.

تحرير الفروق بين خلايا α و α

أ تنتج الخلايا 'أ-factor '، فرمون التزاوج الذي يشير إلى وجود أ خلية إلى خلايا ألفا المجاورة. أ تستجيب الخلايا لعامل ألفا ، فرمون تزاوج خلية ألفا ، من خلال نمو نتوء (يُعرف باسم شمو ، نظرًا لشكله المميز الذي يشبه شخصية الكاب الكرتونية شمو) نحو مصدر عامل ألفا. وبالمثل ، تنتج خلايا ألفا عامل ألفا وتستجيب له أ- عامل نمو الإسقاط نحو مصدر الفرمون. تسمح استجابة الخلايا الفردية فقط لفيرومونات التزاوج من نوع التزاوج المعاكس بالتزاوج بينهما أ وخلايا ألفا ، ولكن ليس بين خلايا من نفس نوع التزاوج.

هذه الاختلافات المظهرية بين أ والخلايا ألفا ناتجة عن مجموعة مختلفة من الجينات يتم نسخها وقمعها بنشاط في خلايا نوعي التزاوج. أ تنشط الخلايا الجينات التي تنتج أ- عامل وينتج مستقبل سطح الخلية (Ste2) الذي يرتبط بعامل ألفا ويطلق الإشارات داخل الخلية. أ تقوم الخلايا أيضًا بقمع الجينات المرتبطة بكونها خلية ألفا. وبالمثل ، تنشط خلايا ألفا الجينات التي تنتج عامل ألفا وتنتج مستقبل سطح الخلية (Ste3) الذي يرتبط ويستجيب لـ أ- العامل وخلايا الفا تقمع الجينات المرتبطة بكونها أ زنزانة.

ال حصيرة تحرير الموقع

المجموعات المختلفة من القمع والتفعيل النسخي التي تميز أ وخلايا ألفا ناتجة عن وجود أحد أليلين من موضع يسمى حصيرة: حصيرةأ أو ماتا يقع على الكروموسوم الثالث. ينقسم موضع MAT عادةً إلى خمس مناطق (W و X و Y و Z1 و Z2) بناءً على التسلسلات المشتركة بين نوعي التزاوج. يكمن الاختلاف في المنطقة Y (Yأ و Yα) ، والذي يحتوي على معظم الجينات والمحفزات.

ال حصيرةأ allele of حصيرة يشفر جين يسمى أ1 ، والذي يوجه نسخ ملف أ- برنامج نصي محدد (مثل التعبير STE2 وقمع STE3) التي تحدد ملف أ زنزانة. ال ماتا allele of حصيرة يشفر الجينات α1 و α2 ، والتي في الأحاديات توجه نسخ برنامج النسخ الخاص بـ α (مثل التعبير STE3القمع STE2) مما يجعل الخلية خلية α. [2] S. cerevisiae has an أ2 مع عدم وجود وظيفة واضحة تشترك في الكثير من تسلسلها مع α2 ومع ذلك ، مثل الخمائر الأخرى المبيضات البيض لديك MAT وظيفية ومميزةأ2 جين. [3] [4]

تحرير الفروق بين الخلايا أحادية الصيغة الصبغية والمزدوجة الصبغية

الخلايا المفصلية هي أحد نوعي التزاوج (أ أو α) ، وتستجيب لفرمون التزاوج الذي تنتجه الخلايا الفردية من نوع التزاوج المعاكس ، ويمكن أن تتزاوج مع خلايا من نوع التزاوج المعاكس. لا يمكن للخلايا المفصلية الخضوع للانقسام الاختزالي. لا تنتج الخلايا ثنائية الصبغة أو تستجيب لأي من فرمون التزاوج ولا تتزاوج ، ولكن يمكن أن تخضع للانقسام الاختزالي لإنتاج أربع خلايا أحادية الصيغة الصبغية.

مثل الاختلافات بين أحادي العدد أ والخلايا ألفا ، فإن الأنماط المختلفة لقمع الجينات وتنشيطها مسؤولة عن الاختلافات المظهرية بين الخلايا أحادية الصيغة الصبغية والخلايا ثنائية الصبغيات. بالإضافة إلى المحدد أ و α أنماط النسخ ، الخلايا أحادية الصيغة الصبغية لكلا النوعين من التزاوج تشترك في نمط نسبي أحادي الصيغة الصبغية ينشط الجينات الفردية (مثل ح) ويقمع الجينات ثنائية الصبغة (مثل IME1). وبالمثل ، تنشط الخلايا ثنائية الصبغيات الجينات ثنائية الصبغيات وتقمع الجينات الفردية.

تعود أنماط التعبير الجيني المختلفة للأشكال الفردية والثنائية الصبغيات مرة أخرى إلى حصيرة المكان. تحتوي الخلايا أحادية الصيغة الصبغية على نسخة واحدة فقط من كل من الكروموسومات الستة عشر ، وبالتالي يمكن أن تمتلك أليلًا واحدًا فقط حصيرة (إما حصيرةأ أو ماتا) ، والذي يحدد نوع التزاوج. تنتج الخلايا ثنائية الصبغة عن تزاوج أ أ خلية وخلية ألفا ، وبالتالي تمتلك 32 كروموسومًا (في 16 زوجًا) ، بما في ذلك كروموسوم واحد يحمل حصيرةأ أليل وكروموسوم آخر يحمل ماتا أليل. مجموعة المعلومات المشفرة بواسطة حصيرةأ أليل ( أ1 الجين) و ماتا يؤدي الأليل (الجينات α1 و α2) إلى تشغيل برنامج النسخ الثنائي الصبغية. وبالمثل ، فإن وجود أليل واحد فقط لـ حصيرة، كيفما كان حصيرةأ أو ماتا، يقوم بتشغيل برنامج النسخ الفردي.

الأليلات الموجودة في حصيرة الموضع كافٍ لبرمجة سلوك التزاوج للخلية. على سبيل المثال ، باستخدام التلاعب الجيني ، أ حصيرةأ يمكن إضافة الأليل إلى أ ماتا خلية احادية. على الرغم من وجود تكملة أحادية العدد من الكروموسومات ، فإن الخلية لديها الآن كلا الصبغيين حصيرةأ و ماتا الأليلات ، وستتصرف كخلية ثنائية الصبغيات: لن تنتج أو تستجيب لفيرومونات التزاوج ، وعندما تجوع ستحاول الخضوع للانقسام الاختزالي ، مما يؤدي إلى نتائج قاتلة. وبالمثل ، حذف نسخة واحدة من حصيرة موضع في خلية ثنائية الصبغيات ، تاركًا واحدة فقط حصيرةأ أو ماتا الأليل ، سوف يتسبب في أن تتصرف الخلية التي تحتوي على تكملة ثنائية الصبغيات من الكروموسومات مثل خلية أحادية الصيغة الصبغية.

يتم تحفيز التزاوج في الخميرة من خلال وجود فرمون يرتبط إما بمستقبل Ste2 (في الخلايا a) أو مستقبل Ste3 (في خلايا ألفا). يؤدي ارتباط هذا الفرمون بعد ذلك إلى تنشيط بروتين G غير المتجانسة. يقوم الجزء الخافت من بروتين G هذا بتجنيد Ste5 (ومكونات سلسلة MAPK المرتبطة به) للغشاء ، وينتج عنه في النهاية فسفرة Fus3.

تنشأ آلية التبديل نتيجة المنافسة بين بروتين Fus3 (بروتين MAPK) و phosphatase Ptc1. These proteins both attempt to control the 4 phosphorylation sites of Ste5, a scaffold protein with Fus3 attempting to phosphorylate the phosphosites, and Ptc1 attempting to dephosphorylate them.

Presence of α-factor induces recruitment of Ptc1 to Ste5 via a 4 amino acid motif located within the Ste5 phosphosites. Ptc1 then dephosphorylates Ste5, ultimately resulting in the dissociation of the Fus3-Ste5 complex. Fus3 dissociates in a switch-like manner, dependent on the phosphorylation state of the 4 phosphosites. All 4 phosphosites must be dephosphorylated in order for Fus3 to dissociate. Fus3's ability to compete with Ptc1 decreases as Ptc1 is recruited, and thus the rate of dephosphorylation increases with the presence of pheromone.

Kss1, a homologue of Fus3, does not affect shmooing, and does not contribute to the switch-like mating decision.

In yeast, mating as well as the production of shmoos occur via an all-or-none, switch-like mechanism. This switch-like mechanism allows yeast cells to avoid making an unwise commitment to a highly demanding procedure. However, not only does the mating decision need to be conservative (in order to avoid wasting energy), but it must also be fast to avoid losing the potential mate.

The decision to mate is extremely sensitive. There are 3 ways in which this ultrasensitivity is maintained:

  1. Multi-site phosphorylation – Fus3 only dissociates from Ste5 and becomes fully active when all 4 of the phosphosites are dephosphorylated. Even one phosphorylated site will result in immunity to α-factor.
  2. Two-stage binding – Fus3 and Ptc1 bind to separate docking sites on Ste5. Only after docking can they bind to, and act on, the phosphosites.
  3. Steric hindrance – competition between Fus3 and Ptc1 to control the 4 phosphosites on Ste3

[a and α yeast share the same mating response pathway, with the only difference being the type of receptor each mating type possesses. Thus the above description, given for a-type yeast stimulated with α-factor, works equally well for α-type yeast stimulated with a-factor.]

Wild type haploid yeast are capable of switching mating type between أ and α. Consequently, even if a single haploid cell of a given mating type founds a colony of yeast, mating type switching will cause cells of both أ and α mating types to be present in the population. Combined with the strong drive for haploid cells to mate with cells of the opposite mating type and form diploids, mating type switching and consequent mating will cause the majority of cells in a colony to be diploid, regardless of whether a haploid or diploid cell founded the colony. The vast majority of yeast strains studied in laboratories have been altered such that they cannot perform mating type switching (by deletion of the ح gene [5] see below) this allows the stable propagation of haploid yeast, as haploid cells of the أ mating type will remain أ cells (and α cells will remain α cells), and will not form diploids.

HML و HMR: the silent mating cassettes Edit

Haploid yeast switch mating type by replacing the information present at the حصيرة المكان. For example, an أ cell will switch to an α cell by replacing the حصيرةأ allele with the ماتا أليل. This replacement of one allele of حصيرة for the other is possible because yeast cells carry an additional silenced copy of both the حصيرةأ و ماتا alleles: the HML (حomothallic مating لeft) locus typically carries a silenced copy of the ماتا أليل و HMR (حomothallic مating صight) locus typically carries a silenced copy of the حصيرةأ أليل. The silent HML و HMR loci are often referred to as the silent mating cassettes, as the information present there is 'read into' the active حصيرة المكان.

These additional copies of the mating type information do not interfere with the function of whatever allele is present at the حصيرة locus because they are not expressed, so a haploid cell with the حصيرةأ allele present at the active حصيرة locus is still an أ cell, despite also having a (silenced) copy of the ماتا allele present at HML. Only the allele present at the active حصيرة locus is transcribed, and thus only the allele present at حصيرة will influence cell behaviour. Hidden mating type loci are epigenetically silenced by SIR proteins, which form a heterochromatin scaffold that prevents transcription from the silent mating cassettes.

Mechanics of the mating type switch Edit

The process of mating type switching is a gene conversion event initiated by the ح الجين. ال ح gene is a tightly regulated haploid-specific gene that is only activated in haploid cells during the G1 مرحلة دورة الخلية. The protein encoded by the ح gene is a DNA endonuclease, which physically cleaves DNA, but only at the حصيرة locus (due to the DNA sequence specificity of the HO endonuclease).

Once HO cuts the DNA at حصيرة, exonucleases are attracted to the cut DNA ends and begin to degrade the DNA on both sides of the cut site. This DNA degradation by exonucleases eliminates the DNA which encoded the حصيرة allele however, the resulting gap in the DNA is repaired by copying in the genetic information present at either HML أو HMR, filling in a new allele of either the حصيرةأ أو ماتا الجين. Thus, the silenced alleles of حصيرةأ و ماتا present at HML و HMR serve as a source of genetic information to repair the HO-induced DNA damage at the active حصيرة المكان.

Directionality of the mating type switch Edit

The repair of the حصيرة locus after cutting by the HO endonuclease almost always results in a mating type switch. عندما أ cell cuts the حصيرةأ allele present at the حصيرة locus, the cut at حصيرة will almost always be repaired by copying the information present at HML. This results in حصيرة being repaired to the ماتا allele, switching the mating type of the cell from أ to α. Similarly, an α cell which has its ماتا allele cut by the HO endonuclease will almost always repair the damage using the information present at HMR, copying the حصيرةأ gene to the حصيرة locus and switching the mating type of α cell to أ.

This is the result of the action of a recombination enhancer (RE) [6] located on the left arm of chromosome III. Deletion of this region causes أ cells to incorrectly repair using HMR. في أ cells, Mcm1 binds to the RE and promotes recombination of the HML region. In α cells, the α2 factor binds at the RE and establishes a repressive domain over RE such that recombination is unlikely to occur. An innate bias means that the default behaviour is repair from HMR. The exact mechanisms of these interactions are still under investigation.

Ruderfer et al. [7] analyzed the ancestry of natural S. cerevisiae strains and concluded that matings involving out-crossing occur only about once every 50,000 cell divisions. Thus it appears that, in nature, mating is most often between closely related yeast cells. Mating occurs when haploid cells of opposite mating type حصيرةأ و ماتا come into contact. Ruderfer et al. [7] pointed out that such contacts are frequent between closely related yeast cells for two reasons. The first is that cells of opposite mating type are present together in the same ascus, the sac that contains the cells directly produced by a single meiosis, and these cells can mate with each other. The second reason is that haploid cells of one mating type, upon cell division, often produce cells of the opposite mating type with which they can mate (see section "Mating type switching", above). The relative rarity in nature of meiotic events that result from out-crossing appears to be inconsistent with the idea that production of genetic variation is the primary selective force maintaining mating capability in this organism. However this finding is consistent with the alternative idea that the primary selective force maintaining mating capability is enhanced recombinational repair of DNA damage during meiosis, [8] since this benefit is realized during each meiosis subsequent to a mating, whether or not out-crossing occurs.

Fission yeast Edit

شيزوساكارومايس بومب is a facultative sexual yeast that can undergo mating when nutrients are limiting. [9] Exposure of S. بومبي to hydrogen peroxide, an agent that causes oxidative stress leading to oxidative DNA damage, strongly induces mating, meiosis, and formation of meiotic spores. [10] This finding suggests that meiosis, and particularly meiotic recombination, may be an adaptation for repairing DNA damage. [11] The overall structure of the حصيرة locus is similar to that in S. cerevisiae. The mating-type switching system is similar, but has evolved independently. [4]

Self-mating in المستخفية الحديثة يحرر

المستخفية الحديثة is a basidiomycetous fungus that grows as a budding yeast in culture and in an infected host. C. neoformans causes life-threatening meningoencephalitis in immune compromised patients. It undergoes a filamentous transition during the sexual cycle to produce spores, the suspected infectious agent. The vast majority of environmental and clinical isolates of C. neoformans are mating type α. Filaments ordinarily have haploid nuclei, but these can undergo a process of diploidization (perhaps by endoduplication or stimulated nuclear fusion) to form diploid cells termed blastospores. [12] The diploid nuclei of blastospores can then undergo meiosis, including recombination, to form haploid basidiospores that can then be dispersed. [12] This process is referred to as monokaryotic fruiting. Required for this process is a gene designated dmc1, a conserved homologue of genes RecA in bacteria, and RAD51 in eukaryotes. Dmc1 mediates homologous chromosome pairing during meiosis and repair of double-strand breaks in DNA (see Meiosis also Michod et al. [13] ). Lin et al. suggested that one benefit of meiosis in C. neoformans could be to promote DNA repair in a DNA damaging environment that could include the defensive responses of the infected host. [12]


شاهد الفيديو: شيف عمر. كيف بتعمل مخلل ناجح. أفضل طريقة لعيار الملح (أغسطس 2022).